Shotgun sequencing

From Freepedia

Shotgun sequencing is a method used in genetics for sequencing long DNA strands. Since the chain termination method can only be used for fairly short strands, it is necessary to divide longer sequences up and then assemble the results to give the overall sequence. In chromosome walking, this division is done by progressing through the entire strand, piece by piece; shotgun sequencing uses a faster, but more complex, process to assemble random pieces of the sequence.

In shotgun sequencing, DNA is broken up randomly into numerous small segments, which are sequenced using the chain termination method to obtain reads. Multiple overlapping reads for the target DNA are obtained by performing several rounds of this fragmentation and sequencing. Computer programs then use the overlapping ends of different reads to assemble them into a contiguous sequence.

For example, consider the following two rounds of shotgun reads:

Original strand               : AGCATGCTGCAGTCATGCTTAGGCTA
First round of shotgun reads  : AGCATGCTGCAG
                                            TCATGCTTAGGCTA
Second round of shotgun reads :                   TTAGGCTA
                                AGCATGCTGCAGTCATGC

In this extremely simplified example, the four reads can be assembled into the original sequence using the overlap of their ends to align and order them. In reality, this process uses enormous amounts of information that are rife with ambiguities and sequencing errors. Assembly of complex genomes is additionally aggravated by the great abundance of repetitive sequence, meaning similar short reads could come from completely different parts of the sequence.

Many overlapping reads for each segment of the original DNA are necessary to overcome these difficulties and accurately assemble the sequence. For example, to complete the Human Genome Project, most of the human genome was sequenced at 12X or greater coverage; that is, each base in the final sequence was present, on average, in 12 reads. Even so, current methods have failed to isolate or assemble reliable sequence for approximately 1% of the (euchromatic) human genome.

This article does not cite its references or sources. You can help Wikipedia by including appropriate citations.

See also



Views
Personal tools
Similar Links