Telomere

From Freepedia

(Redirected from Telomeres)

A telomere is a region of highly repetitive DNA at the end of a chromosome that functions as an aglet. Every time linear eukaryotic chromosomes are replicated, the DNA polymerase complex stops several hundred bases before the end; if it were not for telomeres, this would quickly result in the loss of useful genetic information. In most prokaryotes, chromosomes are circular and thus do not have ends to suffer premature replication termination at. A small fraction of bacterial chromosomes (such as those in Streptomyces and Borrelia) is linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions.

In humans and many other organisms (but not all) telomeres are extended by telomerases, specialized reverse transcriptases that are involved in synthesis of telomeres in most organisms. Telomerases are very interesting DNA polymerases in that they carry an RNA template for the telomere sequence within them.

In humans, the telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but are generally GC-rich.

In most multicellular eukaryotes, telomerase is only active in germ cells. There are theories that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions. These theories remain relatively controversial at this time.

If telomeres become too short, they will uncap. The cell will detect this as DNA damage and will enter cellular senescence (growth arrest). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.

Techniques to extend telomeres are useful for tissue engineering, because they permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.

Advocates of human life extension promote the idea of lengthening the telomeres in certain cells through gene therapy. They reason that this would extend human life. So far these ideas have not been proven in humans. A study done with the worm species Caenorhabditis elegans indicates that lengthening telomeres can extend life. Two groups of worms were created that only differed in telomere length. The worms with the longer telomeres lived 24 days on average, about 20 percent longer than the unmodified worms. A side effect of the longer telomeres was an increased resistance to the effects of heat exposure. The reasons for that effect are unclear. (Joeng, et al., 2004)

A study published in the May 3, 2005 issue of the American Heart Association journal Circulation found that weight gain and increased insulin resistance results in greater telomere shortening over time.

In 2003, scientists observed that the telomeres of the long-lived bird species Leach's Storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age. This is considered the first known instance of such behaviour of telomeres.

A mechanism that limited cellular divisions was first noticed by Leonard Hayflick. Significant discoveries were made by the team led by Professor Liz Blackburn at the University of California - San Francisco. In 1998, Geron Corporation developed techniques for extending telomeres, and proved that they prevented cellular senescence.

Some known telomere sequences
Group Organism Telomeric repeat (5' to 3' toward the end)
Vertebrates Human, mouse, Xenopus TTAGGG
Filamentous fungii Neurospora crassa TTAGGG
Slime moulds Physarum, Didymium
Dictyostelium
TTAGGG
AG(1-8)
Kinetoplastid protozoa Trypanosoma, Crithidia TTAGGG
Ciliate protozoa Tetrahymena, Glaucoma
Paramecium
Oxytricha, Stylonychia, Euplotes
TTGGGG
TTGGG(T/G)
TTTTGGGG
Apicomplexan protozoa Plasmodium TTAGGG(T/C)
Higher plants Arabidopsis thaliana TTTAGGG
Green algae Chlamydomonas TTTTAGGG
Insects Bombyx mori TTAGG
Roundworms Ascaris lumbricoides TTAGGC
Fission yeasts Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Budding yeasts Saccharomyces cerevisiae

Candida glabrata
Candida albicans
Candida tropicalis
Candida maltosa
Candida guillermondii
Candida pseudotropicalis
Kluyveromyces lactis

TGTGGGTGTGGTG (from RNA template)

or G(2-3)(TG)(1-6)T (consensus)
GGGGTCTGGGTGCTG
GGTGTACGGATGTCTAACTTCTT
GGTGTA[C/A]GGATGTCACGATCATT
GGTGTACGGATGCAGACTCGCTT
GGTGTAC
GGTGTACGGATTTGATTAGTTATGT
GGTGTACGGATTTGATTAGGTATGT

Contents

Telomeres and cancer

Telomere maintenance activity is a hallmark of cancer in almost all mammalian organisms. In humans, cancerous tumors acquire indefinite replicative capacity by over-expressing telomerase. However, a sizeable fraction of cancerous cells employ alternative lengthening of telomeres (ALT), a non-conservative telomere lengthening pathway involving the transfer of telomere tandem repeats between sister-chromatids. The mechanism by which ALT is activated is not fully understood because these exchange events are difficult to assess in vivo.

References

  • Joeng KS, Song EJ, Lee KJ, Lee J (2004). Long lifespan in worms with long telomeric DNA. Nature Genetics 36 (6): 607-11. PMID 15122256

Related papers

External links



Views
Personal tools
In other languages
Similar Links